Main Page | See live article | Alphabetical index A subsequence is a sequence which omits some members, for instance, is a subsequence of X where X is , with corresponding index sequence <3,7,9,10> Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. Given X as above, and A common subsequence of X and Y could be This would not be the longest common subsequence, since G only has length 3, and the sequence < B,E,E,B > has length 4. It turns out the longest common subsequence of X and Y would be < B,E,G,C,E,B > Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands. Take two strands of DNA, say ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine. A common problem in subsequences is the Longest-common subsequence problem, where we use dynamic programming to find a maximum length subsequence of two or more sequences. This article is from Wikipedia. All text is available under the terms of the GNU Free Documentation License.